|
Left Crispr |
Right Crispr |
| Crispr ID |
966721326 |
966721328 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:183064950-183064972
|
3:183064963-183064985
|
| Sequence |
CCTTTCTCTCTCTGTGCAAACTG |
GTGCAAACTGGTTGAATGAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 13, 2: 39, 3: 115, 4: 439} |
{0: 20, 1: 30, 2: 62, 3: 57, 4: 216} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|