|
Left Crispr |
Right Crispr |
Crispr ID |
966749722 |
966749728 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:183310460-183310482
|
3:183310505-183310527
|
Sequence |
CCATTGCACTCCAGCCTGGGCAA |
AAAAAAATTACCGGGTGTGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 36772, 1: 108043, 2: 179343, 3: 213379, 4: 164443} |
{0: 1, 1: 7, 2: 114, 3: 1581, 4: 17476} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|