|
Left Crispr |
Right Crispr |
Crispr ID |
966749723 |
966749727 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:183310470-183310492
|
3:183310497-183310519
|
Sequence |
CCAGCCTGGGCAACAGAGTGAGA |
AACTCAAAAAAAAAATTACCGGG |
Strand |
- |
+ |
Off-target summary |
{0: 21776, 1: 73212, 2: 167026, 3: 221294, 4: 302558} |
{0: 1, 1: 1, 2: 73, 3: 2105, 4: 17021} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|