|
Left Crispr |
Right Crispr |
| Crispr ID |
966749725 |
966749737 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:183310495-183310517
|
3:183310545-183310567
|
| Sequence |
CCAACTCAAAAAAAAAATTACCG |
TCCAGCTACTTGGGAGGCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 18, 3: 246, 4: 2444} |
{0: 5379, 1: 101964, 2: 212023, 3: 250600, 4: 262115} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|