ID: 966750610_966750618

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 966750610 966750618
Species Human (GRCh38) Human (GRCh38)
Location 3:183318060-183318082 3:183318095-183318117
Sequence CCGCTCACCTGCAGCTTGTCCCG GGACATGAGAAGGTCTTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 185} {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!