ID: 966769880_966769892

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 966769880 966769892
Species Human (GRCh38) Human (GRCh38)
Location 3:183494339-183494361 3:183494375-183494397
Sequence CCCATAATATCCCACATGTCCAA CCAGGCCAGCCCTACCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 194} {0: 1, 1: 0, 2: 3, 3: 27, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!