ID: 966837348_966837355

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 966837348 966837355
Species Human (GRCh38) Human (GRCh38)
Location 3:184059391-184059413 3:184059431-184059453
Sequence CCTCTGACATCTATTTATTTGCC TCCAGGTGGCCATCAGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 270} {0: 1, 1: 2, 2: 1, 3: 19, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!