ID: 966854125_966854134

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 966854125 966854134
Species Human (GRCh38) Human (GRCh38)
Location 3:184182599-184182621 3:184182652-184182674
Sequence CCAAGTTTCCATAGCAAGTGGTT GGCACCTCCTGCAAGCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158} {0: 1, 1: 0, 2: 1, 3: 39, 4: 621}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!