ID: 966854131_966854139

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 966854131 966854139
Species Human (GRCh38) Human (GRCh38)
Location 3:184182635-184182657 3:184182674-184182696
Sequence CCACTTCTCCTTGTTCTGGCACC GCTCTCTCCTTGCTTGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 320} {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!