ID: 966862024_966862029

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 966862024 966862029
Species Human (GRCh38) Human (GRCh38)
Location 3:184235936-184235958 3:184235969-184235991
Sequence CCACACACAGTCATGTGTACCTC CACAGTCTCTCACACACACTTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 5, 3: 12, 4: 221} {0: 1, 1: 0, 2: 6, 3: 66, 4: 661}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!