ID: 966872710_966872717

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 966872710 966872717
Species Human (GRCh38) Human (GRCh38)
Location 3:184301781-184301803 3:184301813-184301835
Sequence CCTTGACCCACAGAGAAGTGCTT CTGTGCTCTCTTAATCGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 205} {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!