ID: 966892236_966892242

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 966892236 966892242
Species Human (GRCh38) Human (GRCh38)
Location 3:184415962-184415984 3:184416008-184416030
Sequence CCATCCTCAGAGCCTTTACGATG TCCGCCCTGACGTTTCCGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 152} {0: 1, 1: 0, 2: 0, 3: 4, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!