|
Left Crispr |
Right Crispr |
| Crispr ID |
966895098 |
966895104 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:184439038-184439060
|
3:184439078-184439100
|
| Sequence |
CCATCTCAAAAAGAAGAAGAAGA |
AAGGAGAAGGAGAAGGAGAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 65, 2: 765, 3: 9705, 4: 106664} |
{0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|