ID: 966897425_966897435

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 966897425 966897435
Species Human (GRCh38) Human (GRCh38)
Location 3:184456331-184456353 3:184456372-184456394
Sequence CCAGGCACATCCTTGGGGATCCT AGTCCAGGTTGGGCACCGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 180} {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!