ID: 966912679_966912689

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 966912679 966912689
Species Human (GRCh38) Human (GRCh38)
Location 3:184568353-184568375 3:184568383-184568405
Sequence CCTGCAGATACATGGCAGGACGG TGGGGTGCAGCAGGCAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 84} {0: 1, 1: 0, 2: 6, 3: 60, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!