|
Left Crispr |
Right Crispr |
| Crispr ID |
966921851 |
966921858 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:184617229-184617251
|
3:184617282-184617304
|
| Sequence |
CCATTGCACTCCAGCCTGGGCAA |
AAGAAGAAGGAGAAGGAGAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 36772, 1: 108043, 2: 179343, 3: 213379, 4: 164443} |
{0: 18, 1: 73, 2: 370, 3: 1367, 4: 5643} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|