ID: 967051773_967051780

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 967051773 967051780
Species Human (GRCh38) Human (GRCh38)
Location 3:185791589-185791611 3:185791626-185791648
Sequence CCTTCCTCCAGGTGTGCATCACA CCTGGAGGCCATCTTTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203} {0: 1, 1: 0, 2: 0, 3: 26, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!