ID: 967054185_967054192

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 967054185 967054192
Species Human (GRCh38) Human (GRCh38)
Location 3:185813865-185813887 3:185813888-185813910
Sequence CCAGCCATCCCCAAGGAAATGCA AAGGAGAAGGAGAATGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 193} {0: 1, 1: 3, 2: 61, 3: 459, 4: 3016}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!