ID: 967054190_967054192

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 967054190 967054192
Species Human (GRCh38) Human (GRCh38)
Location 3:185813875-185813897 3:185813888-185813910
Sequence CCAAGGAAATGCAAAGGAGAAGG AAGGAGAAGGAGAATGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 582} {0: 1, 1: 3, 2: 61, 3: 459, 4: 3016}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!