ID: 967097739_967097741

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 967097739 967097741
Species Human (GRCh38) Human (GRCh38)
Location 3:186191417-186191439 3:186191446-186191468
Sequence CCTACTCTGTTTTCTGGATTTGT GGCCCCTGAATGACACCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 479} {0: 1, 1: 0, 2: 1, 3: 8, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!