ID: 967098262_967098266

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 967098262 967098266
Species Human (GRCh38) Human (GRCh38)
Location 3:186194657-186194679 3:186194677-186194699
Sequence CCAGGCCAGATCGGAGGTGGAAG AAGCCAGGACTCGGTAGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 107} {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!