ID: 967106083_967106088

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 967106083 967106088
Species Human (GRCh38) Human (GRCh38)
Location 3:186256089-186256111 3:186256110-186256132
Sequence CCATCCACCCTCTGCAGATCAGC GCTTTTCCTTCCTTGGCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 297} {0: 1, 1: 0, 2: 6, 3: 34, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!