ID: 967114972_967114975

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 967114972 967114975
Species Human (GRCh38) Human (GRCh38)
Location 3:186328877-186328899 3:186328893-186328915
Sequence CCTTACACCATTCTTTATTTCCT ATTTCCTTCAAGAAAAGTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 536} {0: 1, 1: 1, 2: 1, 3: 35, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!