ID: 967127697_967127705

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 967127697 967127705
Species Human (GRCh38) Human (GRCh38)
Location 3:186439899-186439921 3:186439912-186439934
Sequence CCGCCTCCCCTCCTGTCCCACTG TGTCCCACTGGAAGGTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 148, 4: 1281} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!