ID: 967127697_967127710

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 967127697 967127710
Species Human (GRCh38) Human (GRCh38)
Location 3:186439899-186439921 3:186439929-186439951
Sequence CCGCCTCCCCTCCTGTCCCACTG TTCAGGGGCAATAACAAGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 148, 4: 1281} {0: 1, 1: 9, 2: 125, 3: 322, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!