ID: 967132923_967132932

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 967132923 967132932
Species Human (GRCh38) Human (GRCh38)
Location 3:186489096-186489118 3:186489140-186489162
Sequence CCCTCCTCATCCCACATAGCCAG CCCTGTGAAAATGATGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 312} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!