ID: 967150281_967150285

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 967150281 967150285
Species Human (GRCh38) Human (GRCh38)
Location 3:186642205-186642227 3:186642242-186642264
Sequence CCTCACTTCTGCTCACCTTCCTG TTATACACAGTCACACGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 709} {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!