ID: 967150281_967150289

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 967150281 967150289
Species Human (GRCh38) Human (GRCh38)
Location 3:186642205-186642227 3:186642252-186642274
Sequence CCTCACTTCTGCTCACCTTCCTG TCACACGTGTTGGGGAGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 709} {0: 1, 1: 0, 2: 0, 3: 21, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!