ID: 967150283_967150286

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 967150283 967150286
Species Human (GRCh38) Human (GRCh38)
Location 3:186642220-186642242 3:186642243-186642265
Sequence CCTTCCTGTGGTTAGAACTCAAT TATACACAGTCACACGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134} {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!