ID: 967173967_967173971

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 967173967 967173971
Species Human (GRCh38) Human (GRCh38)
Location 3:186846016-186846038 3:186846049-186846071
Sequence CCTTAATCTGTCAGTTTCCTCAT GGGCTCATTTCCTTCCTTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 350} {0: 1, 1: 0, 2: 1, 3: 27, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!