ID: 967173980_967173990

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 967173980 967173990
Species Human (GRCh38) Human (GRCh38)
Location 3:186846162-186846184 3:186846181-186846203
Sequence CCCCTCAGCCTTCCCATTTGTAA GTAAAAGCAAGGCAGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 357} {0: 1, 1: 0, 2: 1, 3: 33, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!