ID: 967218496_967218510

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 967218496 967218510
Species Human (GRCh38) Human (GRCh38)
Location 3:187229741-187229763 3:187229788-187229810
Sequence CCTTCCACCTTCTCCCTACCTAG CCCATTCAGGTGTGACAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 408} {0: 1, 1: 0, 2: 1, 3: 17, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!