ID: 967222169_967222178

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 967222169 967222178
Species Human (GRCh38) Human (GRCh38)
Location 3:187256617-187256639 3:187256664-187256686
Sequence CCAAGATTTTCCAGCATCTCCAG CTTGATGTAGTCATAGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 237} {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!