ID: 967222171_967222174

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 967222171 967222174
Species Human (GRCh38) Human (GRCh38)
Location 3:187256627-187256649 3:187256658-187256680
Sequence CCAGCATCTCCAGGACAAGTGTT GCTCACCTTGATGTAGTCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 153} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!