ID: 967269645_967269649

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 967269645 967269649
Species Human (GRCh38) Human (GRCh38)
Location 3:187722451-187722473 3:187722466-187722488
Sequence CCATGCTTCAGCAGGCTTTGGGG CTTTGGGGAGCTCCGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 215} {0: 1, 1: 0, 2: 2, 3: 36, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!