ID: 967320953_967320958

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 967320953 967320958
Species Human (GRCh38) Human (GRCh38)
Location 3:188194570-188194592 3:188194599-188194621
Sequence CCTAGGAAAATCAGGTTGACCAC TGTAGTTCTTGAGGGAAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114} {0: 1, 1: 0, 2: 2, 3: 24, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!