ID: 967322979_967322991

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 967322979 967322991
Species Human (GRCh38) Human (GRCh38)
Location 3:188212516-188212538 3:188212567-188212589
Sequence CCAGCCTGCTTCTCCATATTTGG GGAAGAGAGGGAGGTGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 264} {0: 1, 1: 0, 2: 0, 3: 72, 4: 582}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!