ID: 967341887_967341892

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 967341887 967341892
Species Human (GRCh38) Human (GRCh38)
Location 3:188407672-188407694 3:188407688-188407710
Sequence CCTTCTTTAGTGACTTCAGGGCT CAGGGCTTGGGAATGGGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142} {0: 1, 1: 0, 2: 2, 3: 43, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!