ID: 967417817_967417820

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 967417817 967417820
Species Human (GRCh38) Human (GRCh38)
Location 3:189238614-189238636 3:189238651-189238673
Sequence CCCTCTCTCTTCTGAGTTGATCA CTGTGCTAGGAGAGATGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 253} {0: 1, 1: 0, 2: 0, 3: 20, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!