ID: 967485331_967485342

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 967485331 967485342
Species Human (GRCh38) Human (GRCh38)
Location 3:190023580-190023602 3:190023609-190023631
Sequence CCCCATGACTCAATTACCTCCAC TCTCCCTTGACATGGGCGGCGGG
Strand - +
Off-target summary {0: 10, 1: 403, 2: 2101, 3: 5973, 4: 8986} {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!