ID: 967493633_967493658

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 967493633 967493658
Species Human (GRCh38) Human (GRCh38)
Location 3:190120387-190120409 3:190120437-190120459
Sequence CCCCAACAAGGAGCGGAAAAGGG GGGGCGGGGGCGGGAGCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122} {0: 2, 1: 19, 2: 114, 3: 836, 4: 5090}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!