ID: 967499702_967499704

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 967499702 967499704
Species Human (GRCh38) Human (GRCh38)
Location 3:190183682-190183704 3:190183699-190183721
Sequence CCTGCCTTCATTTCAACATGAAG ATGAAGAAAGAGCCAACAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 39, 4: 503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!