ID: 967529601_967529618

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 967529601 967529618
Species Human (GRCh38) Human (GRCh38)
Location 3:190533485-190533507 3:190533537-190533559
Sequence CCTCCTCCCTCCCCCCTGTGCTT AAGGGGACTTAGGATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 131, 4: 1399} {0: 1, 1: 0, 2: 2, 3: 29, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!