ID: 967542075_967542078

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 967542075 967542078
Species Human (GRCh38) Human (GRCh38)
Location 3:190679699-190679721 3:190679735-190679757
Sequence CCTTCAACCTTGAAACTTGGAAT TTTTCTTTTGCAGCCATATCAGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 4, 3: 27, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!