ID: 967553087_967553089

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 967553087 967553089
Species Human (GRCh38) Human (GRCh38)
Location 3:190822901-190822923 3:190822922-190822944
Sequence CCTGGGTTAGCAAGTAGGTGAGC GCCTGAAGCCTGGTTACACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 18, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!