|
Left Crispr |
Right Crispr |
| Crispr ID |
967557410 |
967557418 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:190876017-190876039
|
3:190876058-190876080
|
| Sequence |
CCTGCTGCGGCCTCCCAAAGTGC |
CCACTGTGCTTGGCTGACACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 56, 1: 2955, 2: 96725, 3: 235081, 4: 237397} |
{0: 1, 1: 2, 2: 9, 3: 62, 4: 458} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|