|
Left Crispr |
Right Crispr |
Crispr ID |
967557415 |
967557418 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:190876031-190876053
|
3:190876058-190876080
|
Sequence |
CCAAAGTGCTAGGATTACAGGCA |
CCACTGTGCTTGGCTGACACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 7892, 1: 107752, 2: 241468, 3: 240344, 4: 208055} |
{0: 1, 1: 2, 2: 9, 3: 62, 4: 458} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|