ID: 967598555_967598561

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 967598555 967598561
Species Human (GRCh38) Human (GRCh38)
Location 3:191357059-191357081 3:191357104-191357126
Sequence CCTGTCTGTTTTTCCTCCATCTA TGTCCTGGAGGACCACACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 396} {0: 1, 1: 0, 2: 1, 3: 25, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!