ID: 967629049_967629059

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 967629049 967629059
Species Human (GRCh38) Human (GRCh38)
Location 3:191721382-191721404 3:191721430-191721452
Sequence CCAGGAATACTTGTGCCATGGCA CAGAAAGGCAAAGAAAGGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 56, 3: 641, 4: 5846}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!