ID: 967674667_967674672

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 967674667 967674672
Species Human (GRCh38) Human (GRCh38)
Location 3:192282456-192282478 3:192282482-192282504
Sequence CCTCCATACTCCCACTATGAGAT TGAAAATTTTCTTTAAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 116} {0: 1, 1: 0, 2: 5, 3: 43, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!